View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_52 (Length: 237)
Name: NF20634_low_52
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 31231814 - 31231948
Alignment:
| Q |
1 |
cggagctttcttagcagccacagctttcttcactgctggcttcttagcagcaacaactttcttccccggagttgtcctcgtcgacgtccttgaagcctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31231814 |
cggagctttcttagcagccacagctttcttcactgctggcttcttagcagcaacaactttcttccccggagttgtcctcgtcgacgtccttgaagcctta |
31231913 |
T |
|
| Q |
101 |
gcaggtttcacaactgtctttgccttggcagcagg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31231914 |
gcaggtttcacaactgtctttgccttggcagcagg |
31231948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University