View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_54 (Length: 234)
Name: NF20634_low_54
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 1951054 - 1951267
Alignment:
| Q |
8 |
cgaagaatatgatgcacgtagtctttgacaaacggtcaaaagaaccttgagcttgaatacaaactcaacatacggatagctctgactagaaccaacttcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951054 |
cgaagaatatgatgcacgtagtctttgacaaacggtcaaaagaaccttgagcttgaatacaaactcaacatacggatagctctgactagaaccaacttcc |
1951153 |
T |
 |
| Q |
108 |
aataactacaatgcttcagatgcatctcattcaacgatgaactatttcattttccctaaaatattttatgaatgttttcttcaatttatgtgtaaaaaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951154 |
aataactacaatgcttcagatgcatctcattcaacgatgaactatttcattttccctaaaatattttatgaatgttttcttcaatttatgtgtaaaaaaa |
1951253 |
T |
 |
| Q |
208 |
tatattaaacgaagc |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1951254 |
-atattaaacgaagc |
1951267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University