View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_55 (Length: 228)
Name: NF20634_low_55
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 213
Target Start/End: Original strand, 40442094 - 40442294
Alignment:
| Q |
13 |
gattatactgatgcatctttacttgcgtacaaattttcttcacaaaattttaatgagtatacaaattttcaagcacacggagtatgatagaaactaaaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40442094 |
gattatactgatgcatctttacttgcgtacaaattttcttcacaaaattttaatgagtatacaaattttcaagcacacggagtatgatagaaactaaaag |
40442193 |
T |
 |
| Q |
113 |
tggaatccacttgtcttaactcttatccctggaatctgtaggtacaacacaaccacacaatcttttaccaacttgatcaatattttggacatccttgtga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40442194 |
tggaatccacttgtcttaactcttatccctggaatctgtaggcacaacacaaccacacaatcttttaccaacttgatcaatattttggacatccttgtga |
40442293 |
T |
 |
| Q |
213 |
t |
213 |
Q |
| |
|
| |
|
|
| T |
40442294 |
t |
40442294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 60
Target Start/End: Original strand, 18812887 - 18812934
Alignment:
| Q |
13 |
gattatactgatgcatctttacttgcgtacaaattttcttcacaaaat |
60 |
Q |
| |
|
||||||| ||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
18812887 |
gattatattgatgcacctttacttacatacaaattttcttcacaaaat |
18812934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University