View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_58 (Length: 216)
Name: NF20634_low_58
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 9699945 - 9699768
Alignment:
| Q |
24 |
tagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggagacaaacttggacgcaagaaagtttatggtgtcacact |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699945 |
tagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggagacaaacttggacgcaagaaagtttatggtgtcacact |
9699846 |
T |
|
| Q |
124 |
cattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccccgaaatctgttatgttaaccctttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
9699845 |
cattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccgcgaaatctgttatgataaccctttg |
9699768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University