View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20635_high_7 (Length: 265)
Name: NF20635_high_7
Description: NF20635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20635_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 32 - 246
Target Start/End: Original strand, 24514191 - 24514407
Alignment:
| Q |
32 |
gttacaactcgagtaatataattggcaaatcttctnnnnnnn-tatcgtattttcaagaatttgatggcatatatattagcattgtnnnnnnnnntt-at |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||| || | |
|
|
| T |
24514191 |
gttacaactcgagtaatataattggcaaatcttataaaaaaaatatcgtattttcaagaatttgatagcatatatattagcattgtaaaaaaaaatttac |
24514290 |
T |
|
| Q |
130 |
accgatttctgataagaagccgtcaattttctatgtcacactatcaatttcgaaaatgaagtgatgtgccaaaataatggattctcgtgaatatcaatgt |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24514291 |
accgatttctgataagaagtcgtcaattttctatgtcacactatcaatttcgaaaatgaagtgatgtgcaaaaataatggattctcgtgaatatcaatgt |
24514390 |
T |
|
| Q |
230 |
aaaaccgttttaagtac |
246 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24514391 |
aaaaccgttttaagtac |
24514407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University