View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20635_high_9 (Length: 212)
Name: NF20635_high_9
Description: NF20635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20635_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 24821952 - 24821777
Alignment:
| Q |
18 |
atgaacggagagctatggtggagtcttttgtgaataagtannnnnnnnnnnnnnnnngaagttgaagcttttgtttaatgttttatgaggtttcataaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24821952 |
atgaacggagagctatggtggagtcttttgtgaataagtattttctttttttcttttgaagttgaagcttttgtttaatgttttatgaggtttcataaat |
24821853 |
T |
 |
| Q |
118 |
aatgctgcattgtgggattttggcatatgaaatgttttgatgtaattgatataggtgcatgcattggcccattaca |
193 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24821852 |
aatgctgcattgtggtattttggcatatgaaatgttttgatgtaattgatataggtgcatgcattggcccattaca |
24821777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University