View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20635_low_10 (Length: 256)
Name: NF20635_low_10
Description: NF20635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20635_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 24514158 - 24513903
Alignment:
| Q |
1 |
gtaaatggcaagcattcaaattggcatctctttctggcttggctgagcccctaggggttattattgtaggtaatatcctctgcttttgctgctttgtacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24514158 |
gtaaatggcaagcattcaaattggcatctctttctggcttggctgagcccctaggggttattattgtaggtaatatcctctgcttttgctgctttgtacc |
24514059 |
T |
 |
| Q |
101 |
atattaacgcatctttggtttgacggagagattaacaaaagtacaatgacaaagttatttcgtgattttgttgaagcttcaaagtatagttgttgtcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24514058 |
atattaacgcatctttggtttgacggagagattaacaaaaatacaatgacaaagttatttcgtgattttgttgaagcttcaaagtatagttgttgttaca |
24513959 |
T |
 |
| Q |
201 |
atgtcacatgattttctcgaacataccattgttacaaatatgcacttattcttctc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24513958 |
ttgtcacatgattttctcgaacataccattgttacaaatatgcacttattcttctc |
24513903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University