View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20639_high_11 (Length: 257)
Name: NF20639_high_11
Description: NF20639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20639_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 14696514 - 14696279
Alignment:
| Q |
1 |
gggagacgttctccattcggtttgaatgggtcccgaagtgctatgaacaccctcctatggggagagatgtgttaggagtaattgaacgaaatgcggaatt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696514 |
gggagacgttctccattcgatttgaatggggcccgaagtgctattaacaccctcctgcggggagagatgtgttaggagtaattgaacgaaatgcggaatt |
14696415 |
T |
 |
| Q |
101 |
ggccttgttttggtttgggcctatgtaaatgagccttaatctactgctcggtcaagaacaaattccatctcaaattaggagacacttaggtgtcatgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696414 |
ggccttgttttggtttgggcctatgtaaatgagccttaatctactgctcggtccagaacaaattccatctcaaattaggagacacttaggtgtcatgaag |
14696315 |
T |
 |
| Q |
201 |
tttatagagtcatacattacttcaatttcaagcaat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696314 |
tttatagagtcatacattacttcaatttcaagcaat |
14696279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University