View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20639_high_20 (Length: 206)
Name: NF20639_high_20
Description: NF20639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20639_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 12861502 - 12861331
Alignment:
| Q |
20 |
cattgaacgccgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
12861502 |
cattgaacgccgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcatagtacggagccagtttgttacaacggaagcagtgg |
12861403 |
T |
|
| Q |
120 |
cggtaacggtgacttcgaagttgatttggctttcatgaatgtagacatggtaagtgcgaaagttttcatatc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12861402 |
cggtaacggtgacttcgaagttgatttggctttcgtgaatgtagacatggtaagtgcgaaggttttcatatc |
12861331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 55 - 191
Target Start/End: Original strand, 12844050 - 12844186
Alignment:
| Q |
55 |
gcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttca |
154 |
Q |
| |
|
||||||| |||||| ||||||| |||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844050 |
gcggagggattgaaaatgatgattgagcatactttggagccagtttgttacgacggaagctgtggcggtaacggtgacttcgaagttgatttggctttca |
12844149 |
T |
|
| Q |
155 |
tgaatgtagacatggtaagtgcgaaagttttcatatc |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12844150 |
tgaatgtagacatggtaagtgcgaaggttttcatatc |
12844186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University