View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20639_high_4 (Length: 465)
Name: NF20639_high_4
Description: NF20639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20639_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 12 - 448
Target Start/End: Original strand, 50536893 - 50537320
Alignment:
| Q |
12 |
gaaaataaacagtagagaagagagataaacgatgaagaagaacatggcgaattcttcagcaacagcattttcaggtgagattccaaacaagaagaacaag |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50536893 |
gaaaacaaacagtagagaagagagataaacgatgaagaagaacatggcgaattcttcaacaacagcattttcaggtgagattccaaacaagaagaacaag |
50536992 |
T |
 |
| Q |
112 |
ggaagttgtgtaatcaatttccctttctcacctgctttaccatcatgcagcatctttgatatgattccaccatcacaatctgatgatcaacaatcttctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50536993 |
ggaagttgtgtaatcaatttccctttctcacctgctttaccatcatgcagcatctttgatatgattccaccatcacaatctgatgatcaacaatcttctt |
50537092 |
T |
 |
| Q |
212 |
cctttgctggttacatcgatttgttgagtacaaatgatttcacttcttcttctgcttcttctgctactttattcgattggtttcccaccattgatactga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50537093 |
cctttgctggttacatcgatttgttgagtacaaatgatttcactt---------cttcttctgctactttattcgattggtttcccaccattgatactga |
50537183 |
T |
 |
| Q |
312 |
catgtcagcaccaccttccaccaccccgctgcctcctttaccggcaccttcccctgccgcgtctgaggtcttgaataatccggccacccctgtctccgtt |
411 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50537184 |
catgtcagcaccaccttccaccacccagctgcctcctttaccggcaccttcccctgccgcgtctgaggtcttgaataatccggccacccctgtctccgtt |
50537283 |
T |
 |
| Q |
412 |
tcttcttcaatttcttcatcttccaatgaagctggtg |
448 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50537284 |
tcttcttcaatttcttcatcttccaatgcagctggtg |
50537320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University