View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20639_high_9 (Length: 357)
Name: NF20639_high_9
Description: NF20639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20639_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 121 - 347
Target Start/End: Complemental strand, 30216591 - 30216365
Alignment:
| Q |
121 |
ggtaaaaagtgatttgtggcattgattaacattaactattaaaatcataataattaatgatttagctttattagtagtctgaaaagtgaaattagtgtca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216591 |
ggtaaaaagtgatttgtggcattgattaacattaattataaaaatcataataattaatgatttagctttattagtagtctgaaaagtgaaattagtgtca |
30216492 |
T |
|
| Q |
221 |
ttaattattcgaaaacgacttaacaagctatcctcaactgttttgtctctctcataactcattcattcaacaactcaaatccagctctactagtacgttt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216491 |
ttaattattcgaaaacgacttaacaagctatcctcaactgttttgtctctctcataactcattcattcaacaactcaaatccagctctactagtacgttt |
30216392 |
T |
|
| Q |
321 |
tctacattacaattaactcacgttcat |
347 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30216391 |
tctacattacaattaactcacgttcat |
30216365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 30216693 - 30216656
Alignment:
| Q |
19 |
acaatactggttttgaatcagtgtttgtcggagggtga |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216693 |
acaatactggttttgaatcagtgtttgtcggagggtga |
30216656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University