View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20639_low_17 (Length: 236)
Name: NF20639_low_17
Description: NF20639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20639_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 12861036 - 12860804
Alignment:
| Q |
1 |
caattggctatgtttctgctttctatcactaatcactatgttgagcatactatggttagcaaagggctataggtctctcgttcttttcatgatcatgagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12861036 |
caattggctatgtttctgctttctatcactaatcactatgttgagcatactacggttagcaaagggctataggtctctcgttcttttcatgttcatgagt |
12860937 |
T |
|
| Q |
101 |
ttaaggaagctatgttttctatacaccgaaataaaagctcagttaacgtcaggctggacgtgtgttctcagatgtcaaaatttagtgttgcatcttcatg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12860936 |
ttaaggaagttatgttttctatacaccgaaataaaagctcagttaacgtcaggttgggcgtgtgttctcagatgtcaaattttagtgttgcatcttcatg |
12860837 |
T |
|
| Q |
201 |
gttgcctctttggttgaggttttggttctctgc |
233 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
12860836 |
gttgcctctttggttgaggtgttggttctctgc |
12860804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 137 - 232
Target Start/End: Original strand, 12833135 - 12833230
Alignment:
| Q |
137 |
gctcagttaacgtcaggctggacgtgtgttctcagatgtcaaaatttagtgttgcatcttcatggttgcctctttggttgaggttttggttctctg |
232 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||| |||||| ||||||||| ||||||||||||||| | |||| |||||||||| |
|
|
| T |
12833135 |
gctcggttaacgtcaggctgggcgtgtgttctcagatgtcaaattttagttttgcatctttgtggttgcctctttggctaaggtgctggttctctg |
12833230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 37 - 125
Target Start/End: Original strand, 12844507 - 12844595
Alignment:
| Q |
37 |
tatgttgagcatactatggttagcaaagggctataggtctctcgttcttttcatgatcatgagtttaaggaagctatgttttctataca |
125 |
Q |
| |
|
|||||||||||||||| |||||||| | |||||||||||| | |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12844507 |
tatgttgagcatactacggttagcacaaggctataggtctttggttcatttcagattcatgagtttaaggaagctatgttttctataca |
12844595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University