View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20639_low_19 (Length: 215)
Name: NF20639_low_19
Description: NF20639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20639_low_19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 56165182 - 56164968
Alignment:
| Q |
1 |
atccacttcttacccttaaaattacaaacaaaacattagaatccataccgggttggttttaatatttacatagacaaaatattacaaatcgaacttagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165182 |
atccacttcttacccttaaaattacaaacaaaacattagaaaccataccgggttggttttaatatttacatagacaaaatattacaaatcgaacttagtt |
56165083 |
T |
|
| Q |
101 |
catgccatatttagatgcaaaatctctaccctagaaagaaagtagagagaaatatattgacttggaatacttgttctcatcaagttgggtgtttctggat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165082 |
catgccatatttagacgcaaaatctctaccctagaaagaaagtagagagaaatatattgacttggaatacttgttctcatcaagttgggtgtttctggat |
56164983 |
T |
|
| Q |
201 |
taagcttcctcaaat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
56164982 |
taagcttcctcaaat |
56164968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University