View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2063_high_13 (Length: 269)
Name: NF2063_high_13
Description: NF2063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2063_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 49521768 - 49522023
Alignment:
| Q |
1 |
cttttttcttgagcatttctcctagggtgatactactttctgttgtcttgtttgggtccctaatcaaggttatttctgcatgaacagaccaaccagttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49521768 |
cttttttcttgagcatttctcctagggtgatactactttctgttgtcttgtttgggtccctaatcaaggttatttctgtatgaacagaccaaccagttat |
49521867 |
T |
|
| Q |
101 |
gtaaataaagactttagcattcataatggcattgtaaatatcttcccaacatcttccaggtacataatattttgttccagatattggaatccacggatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49521868 |
gtaaataaagactttagcattcataatggcattgtaaatatcttcccaacatcttccaggtacataatattttgttccagatattggaatccacggatga |
49521967 |
T |
|
| Q |
201 |
acactctcagggacgtgagcgtcttggtataaagtaacactacaaccttgtctctg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49521968 |
acactctcagggacgtgagcgtcttggtataaagtaacactacaaccttgtctctg |
49522023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 166
Target Start/End: Original strand, 49510864 - 49510989
Alignment:
| Q |
41 |
tgttgtcttgtttgggtccctaatcaaggttatttctgcatgaacagaccaaccagttatgtaaataaagactttagcattcataatggcattgtaaata |
140 |
Q |
| |
|
||||| || |||||| || ||||||||||||||||| | | ||||||||||||||||||| ||||||| ||||||| |||| |||||| || || |
|
|
| T |
49510864 |
tgttgactcgtttggatctctaatcaaggttatttccgtgtaaacagaccaaccagttatgcaaataaaatgcttagcatcattaattgcattgcaagta |
49510963 |
T |
|
| Q |
141 |
tcttcccaacatcttccaggtacata |
166 |
Q |
| |
|
|||||||||||| |||| || ||||| |
|
|
| T |
49510964 |
tcttcccaacattttcccggcacata |
49510989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University