View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2063_low_20 (Length: 225)
Name: NF2063_low_20
Description: NF2063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2063_low_20 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 146 - 225
Target Start/End: Complemental strand, 42582054 - 42581974
Alignment:
| Q |
146 |
actaccgtttaattagccgcaacgtggaaataccattagaatcaactaacattaacaaattaatctga-ccggagaatgct |
225 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
42582054 |
actatcgtttaattagccgcaacgtggaaataccattagaatcagctaacattaacaaactaatctgagccggagaatgct |
42581974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 42582196 - 42582152
Alignment:
| Q |
1 |
ggtgttaaaaagacggtttagtaaccataattaagttgtttgatc |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42582196 |
ggtgttaaaaagacggtttagtaaccataactaagttgtttgatc |
42582152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 209
Target Start/End: Complemental strand, 134089 - 134021
Alignment:
| Q |
141 |
agacgactaccgtttaattagccgcaacgtggaaataccattagaatcaactaacattaacaaattaat |
209 |
Q |
| |
|
|||| |||||||||||| || |||| |||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
134089 |
agacaactaccgtttaactaaccgcggtgtggaaataccaatagaatcagctaacattaacaaactaat |
134021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University