View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20640_high_7 (Length: 270)
Name: NF20640_high_7
Description: NF20640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20640_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 269
Target Start/End: Complemental strand, 54336325 - 54336076
Alignment:
| Q |
20 |
gatacaactgaatccacgctcgtgattgttttagggccatacatcttcatactcatgctgaatttctactatgcacaatgatcaatgctatctgttgata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
54336325 |
gatacaactgaatccacgctcgtgattgttttagggccatacatcttcatactcatgctgaatttctactatgcacaatgaacactgctatctgttgata |
54336226 |
T |
 |
| Q |
120 |
tttgttcagtatgcgtctttcatttgnnnnnnntgtttgacaatccctttttactgttagattcttggcaattcggatttgaagatggaagcagaggttc |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54336225 |
tttgttcagtatgcgtctttcattttaaaaaaatgtttgacaatccctttttactgttagattcttggcaattcggatttgaagatggaagcagaggttc |
54336126 |
T |
 |
| Q |
220 |
ccgtggattagaatgaggatagaaatttccctagagtataatctacccac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
54336125 |
ccgtggattagaatgaggatagaaatttccctagtgtataatatacccac |
54336076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University