View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20641_high_12 (Length: 242)
Name: NF20641_high_12
Description: NF20641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20641_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 122 - 239
Target Start/End: Complemental strand, 35960914 - 35960799
Alignment:
| Q |
122 |
aagaaaaaatcaaccaaaaagaattgaaagatgttannnnnnnnnnatatataatataaatgttacggttatcaagtatccactcgctatttttgactaa |
221 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35960914 |
aagaaaaaatcaactaaaaagaattgaaagatgttattttcttc--atatatagtataaatgttaccgttatcaaatatccactcgctatttttgactaa |
35960817 |
T |
|
| Q |
222 |
tctcaaacaaataatttt |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35960816 |
tctcaaacaaataatttt |
35960799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University