View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20641_high_7 (Length: 304)
Name: NF20641_high_7
Description: NF20641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20641_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 51000694 - 51000577
Alignment:
| Q |
19 |
ttcatgccctttttacatggttatagtgataaataaaataaaaaatcaacttaaacatattcttttgaattgcaggcagttcaaggacattgtcctcgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000694 |
ttcatgccctttttacatggttatagtgataaataaaataaaaaatcaacttaaacatattcttttgaattgcaggcagttcaaggacattgtcctcgtg |
51000595 |
T |
|
| Q |
119 |
cattacggagaggtatgc |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51000594 |
cattacggagaggtatgc |
51000577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 183 - 294
Target Start/End: Complemental strand, 51000528 - 51000417
Alignment:
| Q |
183 |
atgcagatgacatgatgctacattggaaccagaattctggttaatcttagtaatatcaagcacaattgtgttgattttctgtgctatctttcttttaagc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000528 |
atgcagatgacatgatgctacattggaaccagaattctggttaatcttagtaatatcaagcacaattgtgttgattttctgtgctatctttcttttaagc |
51000429 |
T |
|
| Q |
283 |
atggttcctatg |
294 |
Q |
| |
|
||| |||||||| |
|
|
| T |
51000428 |
atgtttcctatg |
51000417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University