View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20641_low_16 (Length: 227)
Name: NF20641_low_16
Description: NF20641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20641_low_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 35961326 - 35961101
Alignment:
| Q |
6 |
acctaaaagacacttataataaatatttgattatttggatggtttcttgcaattccgcaaggactaaaaccaattttattaaagttaacnnnnnnnnnn- |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35961326 |
acctaaaagacacttataataaatatttgattatttggatggtttcttgcaattccgcaaggactaaaaccaattttattaaagttaacaaaaaaaaaaa |
35961227 |
T |
 |
| Q |
105 |
---gaggtgttttacattttatatttatttaggggatgagatgttttacttataaagtgataaaatttgtttgttacatggtatttaaggagatagatta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35961226 |
gaagaggtgttttacattttatatttatttaggggatgagatgttttacttataaagtgatcaaatttgtttgttacatggtatttaaggagatagatta |
35961127 |
T |
 |
| Q |
202 |
tggctgaagttcaaaaaattgtgtat |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35961126 |
tggctgaagttcaaaaaattgtgtat |
35961101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University