View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20641_low_6 (Length: 309)
Name: NF20641_low_6
Description: NF20641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20641_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 39490525 - 39490265
Alignment:
| Q |
11 |
cacagagcagtaatttaatttaaatatgttgttattggcgatttgaagtgtatatttgatattacgaagttggacaaaattatagtatcatggtgagttc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39490525 |
cacagagcagtaatttaatttaaatatgttgttattggcgatttgaagtgtatgtttgatattacgaagttggacaaaattatagtatcatggtgagttc |
39490426 |
T |
|
| Q |
111 |
ataatttgtaacttttgcaagaataggatgcttccccataattttgtaaaacacattgcgatatcaaataagtactagattgtgtcttttggttttgagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39490425 |
ataatttgtaacttttgcaagaataggatgtttcaccataattttgtaaaacacattgcgatatcaaataagtactagattgtgtcttttggttttgagg |
39490326 |
T |
|
| Q |
211 |
ttgatctcgcttgtacatctccgtctccatttgtttttaattttagaaaggaaaaataact |
271 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39490325 |
ttgatctcgcttgtacatctcggtctccatttgtttttaattttagaaaggaaaaataact |
39490265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University