View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20643_high_2 (Length: 343)
Name: NF20643_high_2
Description: NF20643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20643_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 11420633 - 11420967
Alignment:
| Q |
1 |
tgataacttaggtctctctgctgattctgatttgagtgttttttcaaacctctcaaagcttgtgaaactttccatgtccaacaattccatatcgggaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11420633 |
tgataacttaggtctctctgctgattctgatttgagtgttttttcaaacctctcaaagcttgtgaaactttccatgtccaacaattccatatcgggaaaa |
11420732 |
T |
|
| Q |
101 |
ttaccaaataacattgccgatttcaaaagccttgaatttcttgatatttccaataacctcttttcctcatccataccggctggaatcggtaagtttggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11420733 |
ttaccaaataacattgccgatttcaaaagccttgaatttcttgatatttccaataacctcttttcctcatccataccggctggaatcggtaagtttggta |
11420832 |
T |
|
| Q |
201 |
gcttgcagaatctgtcgttggccgggaataacttttccggtccaattccaaactctatttcagaaatggcttccattaaatctttggacttgagtcgcga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11420833 |
gcttgcagaatctgtcgttggccgggaataacttttccggtccaattccaaactctatttcagaaatggcttccattaaatctttggacttgagtcgcaa |
11420932 |
T |
|
| Q |
301 |
cgccctttctggagctctgccgtcgtcgctaccta |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11420933 |
cgccctttctggagctctgccgtcgtcgctaccta |
11420967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University