View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20643_low_1 (Length: 526)

Name: NF20643_low_1
Description: NF20643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20643_low_1
NF20643_low_1
[»] chr2 (1 HSPs)
chr2 (479-514)||(18156391-18156426)


Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 479 - 514
Target Start/End: Complemental strand, 18156426 - 18156391
Alignment:
479 ttacttcatagttcatagatctccttcaaccagaat 514  Q
    ||||||||||||||||||||||||||||||||||||    
18156426 ttacttcatagttcatagatctccttcaaccagaat 18156391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University