View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20645_high_21 (Length: 265)
Name: NF20645_high_21
Description: NF20645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20645_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 51414898 - 51415126
Alignment:
| Q |
19 |
ataaataacatttttatagtcttaannnnnnncataagctttcaatcaaattgagaattcaatctttagatttaattaagaacattcttattcttgtggt |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51414898 |
ataaataacatttttatagtcttaatttttttcataagctttcaatcaaattgagaattcaatctttagatttaattaagaacattcttattcttgtggt |
51414997 |
T |
|
| Q |
119 |
gaatactcaattcaagtttatcannnnnnnnnatgagagtgtgacacttgttctttcgacttctcatcatcttccaccttatatgttctctttctagttt |
218 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51414998 |
gaatactcaattcaaatttat-aattttttttatgagagtgtgacacttgttctttcgacttctcatcatcttccaccttatatgttctctttctagttt |
51415096 |
T |
|
| Q |
219 |
gtttgatttttcttttattttcttaccttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51415097 |
gtttgatttttcttttattttcttaccttt |
51415126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University