View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20645_high_25 (Length: 219)
Name: NF20645_high_25
Description: NF20645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20645_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 43125029 - 43124931
Alignment:
| Q |
98 |
tctaaaatgctttagctagctttgtttacttttgcataatgcagcctgcagccctgcactgcatggccgcaaaaacattctcaaacataataatttgtag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43125029 |
tctaaaatgctttagctagctttgtttacttttgcataatgcagcctgca--------ctgcatggccgcaaaaacattctcaaacataataatttatag |
43124938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 43125159 - 43125086
Alignment:
| Q |
7 |
tcgactgagatgaatactcacatttagtatctgaaatatcttgatt-aattatctccacttgaataaacttaag |
79 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43125159 |
tcgactgagaaaaatactcacatttagtatctgaaatatcttgattaaattatctccacttgaataaacttaag |
43125086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University