View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20645_low_17 (Length: 316)
Name: NF20645_low_17
Description: NF20645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20645_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 35949856 - 35949570
Alignment:
| Q |
1 |
ggcaacacatcaacacgatggtgaatacatagcggtgtaacaacaaaacccgacaaaaccaaacaacctgcaatccaaaagcaggttacaagtacttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35949856 |
ggcaacacatcaacacgatggtgaatacatagcggtgtaacaacaaaacccgacaaaaccaaacaacctgcaatccaaaagcaggttacaagtacttcaa |
35949757 |
T |
|
| Q |
101 |
agtgaatcgcggtgagctaacttcaaaccgcccagaggccagaagtgctaagaggtggtgacgcctatagaagacttgcacaacagcaaaacattctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
35949756 |
agtgaatcgcggtgagctaacttcaaaccgcccagaggccagaagtgctaagaggtggtgacgcctatagaagacttgcacaccaccaaaacattctcta |
35949657 |
T |
|
| Q |
201 |
catgtttcctaaacaagtatggattggaggggaaagaaaactaggaagttggcagacaatttgggtaggcggtgggtgagttccaga |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35949656 |
catgtttcctaaacaagtatggattggaggggaaagaaaactaggaagttggcagacaatctgggtaggcggtgggtgagttccaga |
35949570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University