View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20645_low_23 (Length: 255)
Name: NF20645_low_23
Description: NF20645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20645_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 32 - 241
Target Start/End: Original strand, 40725405 - 40725614
Alignment:
| Q |
32 |
aatgtacaaacgagctatctacgaattctaatgccaggaatgtctttcaaacccatttttagtgcagtttttcggaagagagaaggcggcctctgtaaac |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40725405 |
aatgtacaaacgagctatctacgaattctaatgccaggaatgtctttcaaacccatttttagtgcagtttttcggaagagagaaggcggcctctgtaaac |
40725504 |
T |
|
| Q |
132 |
caattgattcggaaaattggcttgctagctcagctactgtgctcttctccctcccaatttccctgatggagttataataaccaagccaagcatgataggc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40725505 |
caattgattcggaaaattggcttgctagctcagctactgtgctcttctccctcccaatttccctgatggagttataataaccaagccaagcatgataggc |
40725604 |
T |
|
| Q |
232 |
tgcttctttg |
241 |
Q |
| |
|
|||||||||| |
|
|
| T |
40725605 |
tgcttctttg |
40725614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University