View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20645_low_26 (Length: 206)
Name: NF20645_low_26
Description: NF20645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20645_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 85 - 189
Target Start/End: Complemental strand, 43875683 - 43875579
Alignment:
| Q |
85 |
tgtaatttttagcattttaatcaaacccatttgaagtgtttcaaaactaaattagaaaaccaaaacattttattagttcgaatggaactggatttagatc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875683 |
tgtaatttttagcattttaatcaaacccatttgaaatgtttcaaaactaaattagaaaaccaaaacattttattagttcgaatggaactggatttagatc |
43875584 |
T |
 |
| Q |
185 |
ccttt |
189 |
Q |
| |
|
||||| |
|
|
| T |
43875583 |
ccttt |
43875579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University