View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20645_low_26 (Length: 206)

Name: NF20645_low_26
Description: NF20645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20645_low_26
NF20645_low_26
[»] chr7 (1 HSPs)
chr7 (85-189)||(43875579-43875683)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 85 - 189
Target Start/End: Complemental strand, 43875683 - 43875579
Alignment:
85 tgtaatttttagcattttaatcaaacccatttgaagtgtttcaaaactaaattagaaaaccaaaacattttattagttcgaatggaactggatttagatc 184  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43875683 tgtaatttttagcattttaatcaaacccatttgaaatgtttcaaaactaaattagaaaaccaaaacattttattagttcgaatggaactggatttagatc 43875584  T
185 ccttt 189  Q
    |||||    
43875583 ccttt 43875579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University