View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20646_high_10 (Length: 230)

Name: NF20646_high_10
Description: NF20646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20646_high_10
NF20646_high_10
[»] chr7 (1 HSPs)
chr7 (17-217)||(43568508-43568708)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 43568708 - 43568508
Alignment:
17 aatgaggttggtgcggtatctgcttgtgctcatttaggtgctcttgcggctggggagaaagcttatgagcatgcgattagaattaatttggatttgaatg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43568708 aatgaggttggtgcggtatctgcttgtgctcatttaggtgctcttgcggctggggagaaagcttatgagcatgcgattagaattaatttggatttgaatg 43568609  T
117 tgattcttgggacggcgatcgttgatatgtatgcaagatgtggtaatgttgagaaagctgtccgggttttcaaggaaatgaaagagaaggatgtaattag 216  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
43568608 tgattcttgggacggcgatcgttgatatgtatgcaagatgtgggaatgttgagaaagctgtccgggttttcgaggaaatgaaagagaaggatgtaattag 43568509  T
217 t 217  Q
    |    
43568508 t 43568508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University