View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20646_high_6 (Length: 247)
Name: NF20646_high_6
Description: NF20646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20646_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 149 - 230
Target Start/End: Complemental strand, 17174904 - 17174823
Alignment:
| Q |
149 |
attgtcttgtttactttaacaatatcatctgatatgtgttgtcttcatgttgttaactttacacatatttgatggccctctt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17174904 |
attgtcttgtttactttaacaatatcatctgatatatgttgtcttcatgttgttaacattacacatatttgatggccctctt |
17174823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 14 - 79
Target Start/End: Complemental strand, 17175004 - 17174939
Alignment:
| Q |
14 |
gagatgaaatcggaatgcattgggatccatacaagaaacgctttgatttctcggttcttcgtgcct |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17175004 |
gagatgaaatcggaatgcattgggatccatacaagaaacggtttgatttctcggttcttcgtgcct |
17174939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 119
Target Start/End: Original strand, 11798867 - 11798928
Alignment:
| Q |
58 |
gatttctcggttcttcgtgcctatcgtcgtcaagtgagagaccaacattagtttccagtttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||| | ||||||||| ||||||| |
|
|
| T |
11798867 |
gatttctcggttcttcgtgcctatcgccatcaagtttcagacaagcattagttttcagtttt |
11798928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University