View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20646_low_10 (Length: 246)
Name: NF20646_low_10
Description: NF20646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20646_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 75 - 168
Target Start/End: Original strand, 26453519 - 26453612
Alignment:
| Q |
75 |
taagaaaactaggaaagaataggcgttggagatgctcttatgacttaacatgttttttaagaccctagatgcagttccctcgtgtgatgtaccc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453519 |
taagaaaactaggaaagaataggcgttggagatgctcttatgacttaacatgttttttaagaccctagatgcagttccctcgtgtgatgtaccc |
26453612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 26453468 - 26453387
Alignment:
| Q |
1 |
tgaccctgtggagaaaaattctcccactagaacatgttctagcactgactgcattagaaaaagtacagaaaaggtaagaaaa |
82 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453468 |
tgaccctgtggagaacaattctcccactagaacatgttctagcactgactgcattagaaaaagtacagaaaaggtaagaaaa |
26453387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 167 - 230
Target Start/End: Original strand, 26454087 - 26454150
Alignment:
| Q |
167 |
cctgaaccttgtatgcatcacgcataatgcattgattgaatagcttcaactgttctcaaatttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
26454087 |
cctgaaccttgtatgcatcacgcataatgcattgattgaatagcttcaactattttcaaatttt |
26454150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University