View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20646_low_14 (Length: 230)
Name: NF20646_low_14
Description: NF20646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20646_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 43568708 - 43568508
Alignment:
| Q |
17 |
aatgaggttggtgcggtatctgcttgtgctcatttaggtgctcttgcggctggggagaaagcttatgagcatgcgattagaattaatttggatttgaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568708 |
aatgaggttggtgcggtatctgcttgtgctcatttaggtgctcttgcggctggggagaaagcttatgagcatgcgattagaattaatttggatttgaatg |
43568609 |
T |
 |
| Q |
117 |
tgattcttgggacggcgatcgttgatatgtatgcaagatgtggtaatgttgagaaagctgtccgggttttcaaggaaatgaaagagaaggatgtaattag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43568608 |
tgattcttgggacggcgatcgttgatatgtatgcaagatgtgggaatgttgagaaagctgtccgggttttcgaggaaatgaaagagaaggatgtaattag |
43568509 |
T |
 |
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
43568508 |
t |
43568508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University