View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20646_low_15 (Length: 216)
Name: NF20646_low_15
Description: NF20646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20646_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 11587229 - 11587052
Alignment:
| Q |
1 |
ccactttttgtctaggataaataccaataattatatggttggtatttaattgcaatttaataatacaatcatgttcctagatgtaattaactcttaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11587229 |
ccactttttgtctaggataaataccaataattatatgattggtatttaattgcaatttaataatacaatcatgttcctagatg----taactcttaattt |
11587134 |
T |
|
| Q |
101 |
aagaaagtggtcagtgttaatgatttatatataatcccctcaaatgtgtgtttgagtccttttaagatcacccataatgtgt |
182 |
Q |
| |
|
|||||||| |||| ||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11587133 |
aagaaagttgtcaatgttaatgatttacatataataccctcaaatgtgtgtttgagtccctttaagatcacccataatgtgt |
11587052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University