View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20646_low_4 (Length: 340)
Name: NF20646_low_4
Description: NF20646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20646_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 42825866 - 42825623
Alignment:
| Q |
19 |
ggttactggtttgttttgtacctcacgaaaaaagctagtttttccttgagaaagagattttcaagttgacgactcttcaagtttgctgaattcatgtcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42825866 |
ggttactggtttgttttgtacctcacgaaaaaagctagtttttccttgagaaagagattttcaagttgacgactcttcaagtttgctgaattcatgtcaa |
42825767 |
T |
|
| Q |
119 |
caatggtataatttttggtgatgtacatcatttaaaatataatttttggttgtttgtgataaagatattcaattatatcttgtaagtgcctgtggctgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42825766 |
caatggtataatttttggtgatgtacatcatttaaaatataatttttggttgtttgtgataaagatattcaattatatcttgtaagtgcctgtggctgtg |
42825667 |
T |
|
| Q |
219 |
taaccttctaagggtagtataattcaattctgtttagcattgtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42825666 |
taaccttctaagggtagtataattcaattctgtttagcattgtt |
42825623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 42846522 - 42846486
Alignment:
| Q |
32 |
ttttgtacctcacgaaaaaagctagtttttccttgaga |
69 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42846522 |
ttttgtacctcac-aaaaaagctagtttttccttgaga |
42846486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University