View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20647_high_6 (Length: 304)
Name: NF20647_high_6
Description: NF20647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20647_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 24509098 - 24508975
Alignment:
| Q |
20 |
tttccgagttccttgcattcaaatttaccccactctttaccaacaatcgaagtgcctgtgcagcttcctagtaattaaagaacaatagatttcatttgtt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24509098 |
tttccgagttctttgcattcaaatttaccccactctttaccaacaatcgaagtgcctgtgcagcttcctagtaattaaagaacaatagatttcatttgtt |
24508999 |
T |
 |
| Q |
120 |
agagatcattcataataggcaaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24508998 |
agagatcattcataataggcaaaa |
24508975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 175 - 304
Target Start/End: Complemental strand, 24508846 - 24508714
Alignment:
| Q |
175 |
tatgttctctttcgaacaaaaatgtcacaaactaattaaaaggaacataaggttacctcaggctgtggatgtggctgga---tcattagcgccgctaata |
271 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
24508846 |
tatgttttctttcgaacaaaaatgtcacaaactaattaaaaggaacataaggttacctcaggctgtggatttggctggatcatcattagcgccgctaata |
24508747 |
T |
 |
| Q |
272 |
tgtgcaaaattgtattgccaatctcatcctttt |
304 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| |
|
|
| T |
24508746 |
tgtgcaaaatggtgttgccaatctcatcctttt |
24508714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University