View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20648_high_13 (Length: 273)
Name: NF20648_high_13
Description: NF20648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20648_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 259
Target Start/End: Original strand, 55245027 - 55245270
Alignment:
| Q |
17 |
aaaaggtgaaggttgagatcagatgaatttatcaatgaaatgaaata-tggtaagcagaaaaagtaatgaaaccctcgtttcgtttcacttgaccaaaag |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55245027 |
aaaaggtgaaggttgagatgagatgaatttatgaatgaaatatggtagtcccaagcagaaaaagtaatgaaaccctcgtttcgtttcacttgaccaaaag |
55245126 |
T |
 |
| Q |
116 |
aaaggaccagtacttggtagccacgatgtgtccctatcttcatgtgaaacagtgtctttttccttaccttcttttacactagaaaacaatcttaattcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55245127 |
aaaggaccagtacttggtagccacgatgtgtccctatcttcatgtgaaacagtgtctttttccttaccttcttttacactagaaaacaatcttaattcaa |
55245226 |
T |
 |
| Q |
216 |
caaagtctgatgaaaatccttcaaacttatatcatataccatct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55245227 |
caaagtctgatgaaaatccttcaaacttatatcatataccatct |
55245270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University