View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20648_high_8 (Length: 332)
Name: NF20648_high_8
Description: NF20648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20648_high_8 |
 |  |
|
| [»] scaffold0023 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0023 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 13 - 332
Target Start/End: Complemental strand, 112379 - 112059
Alignment:
| Q |
13 |
attctctagaagtgaagtttgtcagatggggtgggccaattgttggcgaggcacaaacagactgaggtaagaaacagacgtcagaaagcgatgga-ccgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
112379 |
attctctagaagtgaagtttgtcagatggggtgggccaattgttggcgaggcacaaacagactgaggtaagaaacagacgtcagaaagcgatggaaccgg |
112280 |
T |
 |
| Q |
112 |
tggtgcagggacaatatagacaaccgaagagcaacaaacacagtgaatggttgggaagatggtcgtgagaaaggttacgataggattagtaggttttcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112279 |
tggtgcagggacaatatagacaaccgaagagcaacaaacacagtgaatggttgggaagatggtcgtgagaaaggttacgataggattagtaggttttcta |
112180 |
T |
 |
| Q |
212 |
atcaataactgggatatctagggatcacgattcctcatttatggttaggtttaaacaacggtgagacaggttggtttttcgtcgcaatcatcgaaattat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
112179 |
atcaataactgggatatctagggatcacgattcctcatttatggttaggtttaaacaacggtgagacaggttagtttttcgtcgcaatcatcgaaattat |
112080 |
T |
 |
| Q |
312 |
cattcaagaaggctttcatgc |
332 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
112079 |
cattcaagaaggctttcatgc |
112059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University