View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20648_low_10 (Length: 302)
Name: NF20648_low_10
Description: NF20648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20648_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 5017321 - 5017034
Alignment:
| Q |
1 |
cacccaaaccacggtctctgctgtaccgggcttcccggttagaagctccataagcactacaccgaaacagtaaacgtctgtttcggtgctgcaatttgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017321 |
cacccaaaccacggtctctgctgtaccgggcttcccggttagaagctccataagcactacaccaaaacagtaaacgtctgtttcggtgctgcaatttgga |
5017222 |
T |
|
| Q |
101 |
ggacattgttgtccgaattttctaaatccgaaatcggcaatacgaggctcaaagtcatcggctagtagaacgtttgatgttactagatgtccatgaacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017221 |
ggacattgttgtccgaattttctaaatccgaaatcggcaatacgaggctcaaagtcatcggctagtagaacgtttgatgttactagatgtccatgaacga |
5017122 |
T |
|
| Q |
201 |
cgggccttgatcctgcatggtggagaaatgctagaccacgcgctactcctagagcaatacggtgtcgtgttggccaccccattttttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017121 |
cgggccttgatcctgcatggtggagaaatgctagaccacgcgctactcctagagcaatacggtgtcgtgttggccaccccattttttc |
5017034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University