View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_high_21 (Length: 302)
Name: NF2064_high_21
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_high_21 |
 | |
|
| [»] scaffold0474 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 99 - 186
Target Start/End: Complemental strand, 24260057 - 24259970
Alignment:
| Q |
99 |
tttcatccctaaatggtcttccacatctcaaatctcttgacttaagttacaacaacttgaaaggatctcttgatattggtggtgagta |
186 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
24260057 |
tttcatccctaaatggtcttccacgtctcaaatctcttgacttaagttacaacaacttgaatggatcgcttgatattagtggtgagta |
24259970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 24260333 - 24260285
Alignment:
| Q |
32 |
ttttatatatcagagaatcaaggatttggatatgcatggccgtccagtt |
80 |
Q |
| |
|
|||||| ||||||||||||| ||||||| || ||||||||| ||||||| |
|
|
| T |
24260333 |
ttttatttatcagagaatcatggatttgaatttgcatggccctccagtt |
24260285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 82 - 185
Target Start/End: Complemental strand, 8539 - 8436
Alignment:
| Q |
82 |
tttgagtaactatattctttcatccctaaatggtcttccacatctcaaatctcttgacttaagttacaacaacttgaaaggatctcttgatattggtggt |
181 |
Q |
| |
|
|||||||||| |||||||||| ||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8539 |
tttgagtaacagcattctttcatacctaaataatcttccacatctgaaatctcttgacttaagtgccaacaacttgaaaggatcacttgatattagtggt |
8440 |
T |
|
| Q |
182 |
gagt |
185 |
Q |
| |
|
|||| |
|
|
| T |
8439 |
gagt |
8436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 8630 - 8568
Alignment:
| Q |
18 |
acatgttctcaattttttatatatcagagaatcaaggatttggatatgcatggccgtccagtt |
80 |
Q |
| |
|
|||||| ||||||||||| ||||||||| ||||| || ||||||| ||||||||| ||||||| |
|
|
| T |
8630 |
acatgtactcaattttttttatatcagaaaatcatgggtttggatttgcatggccatccagtt |
8568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University