View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_high_29 (Length: 226)
Name: NF2064_high_29
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_high_29 |
 |  |
|
| [»] scaffold1524 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 13997993 - 13997785
Alignment:
| Q |
1 |
ggtttaacgaattcttcacaccgttactccaaaaccaaccatcgtctcttccattcattcaaagtctctaataacgttcgtgtcttttcagagctgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13997993 |
ggtttaacgaattcttcacaccgttactccaaaaccaaccatcgtctcttccattcattcaaagtctctaataacgttcgtgtcttttcagagctgaaga |
13997894 |
T |
 |
| Q |
101 |
gtcaaaacaaaattgattacaatgatcctgattggaaagataagtttaaagaagattttgaggcacggtttagactccctcatgttactgatattttccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13997893 |
gtcaaaacaaaattgattacaatgatcctgattggaaagataagtttaaagaagattttgaggcacggtttagactccctcatattactgatattttccc |
13997794 |
T |
 |
| Q |
201 |
tgatgcttc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
13997793 |
tgatgcttc |
13997785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 128 - 209
Target Start/End: Original strand, 28327293 - 28327374
Alignment:
| Q |
128 |
ctgattggaaagataagtttaaagaagattttgaggcacggtttagactccctcatgttactgatattttccctgatgcttc |
209 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28327293 |
ctgattggaaaactaagttaaaagaagattttgaggcacggtttagactccctcatgttactgatattttccctgatgcttc |
28327374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 209
Target Start/End: Original strand, 28331217 - 28331253
Alignment:
| Q |
173 |
gactccctcatgttactgatattttccctgatgcttc |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28331217 |
gactccctcatgtcactgatattttccctgatgcttc |
28331253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1524 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold1524
Description:
Target: scaffold1524; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 209
Target Start/End: Original strand, 291 - 327
Alignment:
| Q |
173 |
gactccctcatgttactgatattttccctgatgcttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
291 |
gactccctcatgttactgatattttccctgatgcttc |
327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University