View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_low_19 (Length: 338)
Name: NF2064_low_19
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 297
Target Start/End: Original strand, 37879466 - 37879744
Alignment:
| Q |
19 |
cagctttatcaagcgtttcatcaacagtctttcgttttcccaaagcaacttgtagagaatgcgaaccgtcatcgacggcagaagaagaagaaggatattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37879466 |
cagctttatcaagcgtttcatcaacagtctttcgttttcccaaagcaacttgtagagaatgcgaaccgtcatcaacggcagaagaagaagaaggatattg |
37879565 |
T |
 |
| Q |
119 |
attatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcaccgcaagcagaaaaaccttcatcagaa |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879566 |
atgatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcaccgcaagcagaaaaaccttcatcagaa |
37879665 |
T |
 |
| Q |
219 |
gaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatcgtcaa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879666 |
gaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatcgtcaa |
37879744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University