View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_low_23 (Length: 329)
Name: NF2064_low_23
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 9872318 - 9872630
Alignment:
| Q |
1 |
gaagtgtgattagtttggtttttatggattgggattggaaagagtttgcttgggatccatctggatttgatgaggagttgaagaatgaaggagattcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9872318 |
gaagtgtgattagtttggtttttatggattgggattggaaagagtttgcttgggatccatctggatttgatgaggagttgaagaatgaaggagattcaat |
9872417 |
T |
 |
| Q |
101 |
ggatttgaggcttggtgatcaagcttctgattcattggaaaaatcagttcatgattcaggaaaggaagattcaaaagctgtgtcatcgtcgttgtcgcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9872418 |
ggatttgaggcttggtgatcaagcttctgattcattggaaaaatcagttcatgattcaggaaaggaagattcaaaagctgtgtcatcgtcgttgtcgcct |
9872517 |
T |
 |
| Q |
201 |
agtggatcgttgaaaagatcgcgtttacaaaatggatcgcagagtatgatttgctcggttgatggatgtaactctgatcttagtgattgtagagagtatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9872518 |
agtggatcgttgaaaagatcgcgtttacaaaatggatcgcagagtatgatttgctcggttgatggatgtaactctgatcttagtgattgtagagagtatc |
9872617 |
T |
 |
| Q |
301 |
ataagcgtcatag |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9872618 |
ataagcgtcatag |
9872630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University