View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_low_31 (Length: 249)
Name: NF2064_low_31
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 22025825 - 22025999
Alignment:
| Q |
1 |
attggaagctcgcacttaggatagtttatattgagaaactatcaaactaactaaaattgaaaatgggggatttgaactgtgttaaggtgcaaagaacgaa |
100 |
Q |
| |
|
||||||||| ||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22025825 |
attggaagcacgcactttcgatagtttattttgagaaactatcaaactaactaacattgaaaatgggggatttgaactgtgttaaggtgcaaagaacgaa |
22025924 |
T |
|
| Q |
101 |
cactactttatagattgttgttgtgcgattataagtgatnnnnnnnggatccttaagtcgattgaatcttgccac |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
22025925 |
cactactttatagattgttgttgtgcgattataagtgataaaaaaatgatccttaagttgattgaatcttgccac |
22025999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University