View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_low_32 (Length: 243)
Name: NF2064_low_32
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 22025454 - 22025227
Alignment:
| Q |
1 |
ggagaaagaatagaacacggtgttctgaatacgtagtttctaaaggtgaaaaaatctgctcagccttcctagttctagaacatgcaacctattgaatcta |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22025454 |
ggagaaagaatagaacacgatgttctgaatacgtagtttctaaaggtgaaaaaatctgctcagccttcctagttctagaacatgcaacctattggatcta |
22025355 |
T |
 |
| Q |
101 |
ttaaaatcagttccaacatatgattctcatattgaaacatatcgaacactggacaagatttcaattagaagtgttggttctacatagacaacttccatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22025354 |
ttaaaatcagttccaacatatgattctcatattgacacatatcgaacactggacaagatttcaattagaagtgttggttctacatagacaacttccatgt |
22025255 |
T |
 |
| Q |
201 |
cttttccaaaatgtgggttgcttactct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
22025254 |
cttttccaaaatgtgggttgcttactct |
22025227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 225
Target Start/End: Complemental strand, 22015538 - 22015477
Alignment:
| Q |
164 |
attagaagtgttggttctacatagacaacttccatgtcttttccaaaatgtgggttgcttac |
225 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
22015538 |
attagaagtgttggtgctacacagacaacttccatgtcttttacaaaaagtgggttgcttac |
22015477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University