View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2064_low_5 (Length: 597)
Name: NF2064_low_5
Description: NF2064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2064_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 5e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 327 - 495
Target Start/End: Original strand, 10371014 - 10371182
Alignment:
| Q |
327 |
attatttctttctaatgatgatatttttcaaatgtgtttgggtggtttccactcaaaagttcctagaatgctaggcttgtattcaagaaatggagttcct |
426 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
10371014 |
attatttctttctaatgatgatattcttcaaatgtgtttgggtggtttccactcaaaagttcctagaatgctaggctcgtgttcaaataatggagttcct |
10371113 |
T |
 |
| Q |
427 |
taattactaatcctaaactcattcgtatgagaaagattagtactcaatatcaacatctatggttgtttg |
495 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10371114 |
taattactaatcctaaactcattcgtatgagaaagattggtactcaatatcaacatctatggttgtttg |
10371182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 10667257 - 10667228
Alignment:
| Q |
18 |
aaaataatgatcaaatttccatttagaatc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10667257 |
aaaataatgatcaaatttccatttagaatc |
10667228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University