View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20650_high_5 (Length: 238)
Name: NF20650_high_5
Description: NF20650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20650_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 22059549 - 22059657
Alignment:
| Q |
18 |
actttcgttcctcttcttttaggtcaattatcatttttatgtacttaattattttagaccatttatgaatgttatatggacctattgtacacaaacatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22059549 |
actttcgttcctcttcttttaggtaaattatcatttttatgtacttaattattttagaccatttatgaattttatatggacctattgtacacaaacatgt |
22059648 |
T |
|
| Q |
118 |
ttcgaatcc |
126 |
Q |
| |
|
||| ||||| |
|
|
| T |
22059649 |
ttcaaatcc |
22059657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 22059741 - 22059769
Alignment:
| Q |
210 |
gtttctaagtttggtgcattatcaaggtt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22059741 |
gtttctaagtttggtgcattatcaaggtt |
22059769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University