View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20652_high_7 (Length: 320)
Name: NF20652_high_7
Description: NF20652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20652_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 32 - 308
Target Start/End: Complemental strand, 41069204 - 41068929
Alignment:
| Q |
32 |
aataattacgggtatagggagtaaaatcttactaatagctctttccaacatgaaacttaataactagtggcacactgacactactgtacttgtttaatgc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41069204 |
aataattacgggtatagggagtaaaatcttactaatagctctttccaacatgaaact-aataactagtggcacactgacactactgtacttgtttactgc |
41069106 |
T |
|
| Q |
132 |
cttggttatgttctacctctgcttgccaatagctagtaataattttttgttctaaaagaaagtacccacgtccctatgaaaatagcttcaaaatctaaag |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41069105 |
cttggttatgttctacctctgcttgccaatagctagtaataattttttgttctaaaagaaagtacccacgtccctatgaaaatagcttcaaaatctaaag |
41069006 |
T |
|
| Q |
232 |
ttgggccctattttgagaaatacttacagtctatctcaccgaataatcaatatgaagctctaaacaccgtcattctc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41069005 |
ttgggccctattttgagaaatacttacagtctatctcaccgaataatcaatatgaagctctaaacaccgttattctc |
41068929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University