View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_high_17 (Length: 362)
Name: NF20654_high_17
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 330
Target Start/End: Original strand, 41066229 - 41066540
Alignment:
| Q |
19 |
agatcgatcgatgttattacgatctcttcaacaaactcctctgcagaacattttatataatcccatctgcaaggatttttgtgagttggatcccatgatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066229 |
agatcgatcgatgttattacgatctcttcaacaaactctgctgcagaacattttatataatcccatctgcaaggatttttgtgagttggatcccatgatg |
41066328 |
T |
|
| Q |
119 |
agaaagtagtggtagggacagaatttgaggagttgaaagttgaaagccatgaaagtagagagagaccttcttggtttagagaagaaatgaatggaaacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066329 |
agaaagtagtggtagggacagaatttgaggagttgaaagttgaaagccatgaaagtagagagagaccttcttggtttagagaagaaatgaatggaaacaa |
41066428 |
T |
|
| Q |
219 |
ggagatagtgagaaacaagataagaaaatttaatgcattgtttgacatgatgagttggttttctgctactgttctatctcatctaaaacatagcagcagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066429 |
ggagatagtgagaaacaagataagaaaatttaatgcattgtttgacatgatgagttggttttctgctactgttctatctcatctaaaacatagcagcagt |
41066528 |
T |
|
| Q |
319 |
actattttttct |
330 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
41066529 |
actagtttttct |
41066540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University