View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_high_25 (Length: 287)
Name: NF20654_high_25
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 41 - 191
Target Start/End: Complemental strand, 29053596 - 29053446
Alignment:
| Q |
41 |
atagtcattgttagtgttgtcttcgtacaagtttgtatgcaaaaactatgaacactacttcatcacaatatcatgcttggcagaagatattatgtacctt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29053596 |
atagtcattgttagtgttgtcttcgtacaagtttgtatgcaaaaactatgaacactgcttcatcacaatatcatgcttggcagaagatattatgtacctt |
29053497 |
T |
 |
| Q |
141 |
ttcaatatcattcctaatgttttcttcttttcatgttagtctaactcaata |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29053496 |
ttcaatatcattcctagtgttttcttcttttcatgttagtctaactcaata |
29053446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 190 - 275
Target Start/End: Complemental strand, 29053162 - 29053077
Alignment:
| Q |
190 |
taaatttatgtcttatataagcattttaagacttgaatgaaaatgtggtccttttatttatgcttcagaacccttgctgatatttt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29053162 |
taaatttatgtcttatataagcattttaagacttgaatgaaaatgtggtccttttatttatgcttcagaacccttgctgatatttt |
29053077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 29057737 - 29057692
Alignment:
| Q |
193 |
atttatgtcttatataagcattttaagacttgaatgaaaatgtggt |
238 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29057737 |
atttatgtctaatataagcattttaagacttgcatgaaaatgtggt |
29057692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 44
Target Start/End: Complemental strand, 29053633 - 29053605
Alignment:
| Q |
16 |
ataaaaactactgcagaataataatatag |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29053633 |
ataaaaactactgcagaataataatatag |
29053605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University