View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_high_27 (Length: 271)
Name: NF20654_high_27
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 255
Target Start/End: Complemental strand, 30319161 - 30318915
Alignment:
| Q |
9 |
attattctactatgtttccctccacatagttccattcttctattgtgttatacactaactcatgttaagttaattaaaattgaggaaactgtatggagac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30319161 |
attattctactatgtttccctccacatagttccattcttctattgtgttatacactaactcatgttaagttacttaaaattgaggaaactgtatggagac |
30319062 |
T |
|
| Q |
109 |
aagggagcagatccatgcggttgaaggacggagatctaaacataaaattcttgcatgaaaaggaggaaagtggatgagattaaaaagttaaaagacaaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319061 |
aagggagcagatccatgcggttgaaggacggagatctaaacataaaattcttgcatgaaaaggaggaaagtggatgagattaaaaagttaaaagacaaag |
30318962 |
T |
|
| Q |
209 |
caggtgtttggtggaagaggaaagagaacgttgaaaacacttgtgag |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30318961 |
caggtgtttggtggaagaggaaagagaacgttgaaaacacttgtgag |
30318915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University