View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20654_high_32 (Length: 250)
Name: NF20654_high_32
Description: NF20654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20654_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 48818302 - 48818541
Alignment:
| Q |
1 |
ggctctaacgagggaactttatgggtgaaaatgaacgtcacatgacataaatttagaagcnnnnnnntaggagattccgaagttgctctctagtttttac |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
48818302 |
ggctctaacgagggaactttatgggcgaaaatgaacgtcacatgacataaatttagaagcaaaaaaataggagattccgaagttgctctctagtttttgc |
48818401 |
T |
|
| Q |
101 |
ggttttgtgaatgcaatttaccaaactttaaggtgtgtttggatggggaagattggaggtgatgagaggcaggggaaggttattaattaaaagagttact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818402 |
agttttgtgaatgcaatttaccaaactttaaggtgtgtttggatggggaagattggaggtgatgagaggcaggggaaggttattaattaaaagagttact |
48818501 |
T |
|
| Q |
201 |
atttaagtgaaaaggtttataggtagttcttctccttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818502 |
atttaagtgaaaaggtttataggtagttcttctccttcat |
48818541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University